Episode 7: Data Standardization
Capture, management, and sharing of research data and metadata are a growing concern for the biopharma industry. Learn how data standardization can facilitate collaboration and improve accessibility.
Episode 6: Genomic Data Disparities
Sequencing is used to identify novel drug targets and genetically stratifying clinical trial patients, improving the power of precision medicine. However, the global disparity of genomic technologies is increasing. How will this affect drug development, particularly for non-European ethnicities? Why is it important to have a global context for targeted therapies?
Episode 5: Lab of the Future (LoTF)
Life science companies are looking to modernize their research environments and build the Lab of the Future. From early discovery to preclinical research, how can technology help automate the lab and accelerate discoveries?
Episode 4: Active Learning in Drug Discovery
What are the theories, algorithmic principles, and limitations of active learning? What are some current applications of active learning within BioPharma drug screening and optimization? How can active learning accelerate multi-dimensional drug discovery? Find out here.
Episode 3: Next-Generation Data Integration, Visualization, and Exploration
What is the vision of interactive data exploration beyond enriching visualizations and facilitating the integration of data? Within the context of research, what are the challenges and opportunities in building next-generation visual analytics? Listen to find out.
Episode 2: The Realities of AI/ML
Artificial Intelligence (AI) and Machine Learning (ML) are big topics getting lots of attention within BioPharma. What is the role of AI/ML in genomics? How can we separate the hype of AI/ML from reality? Listen in to find out this and more.
PrimePCR ddPCR Mutation Assay Validation Data
Gene Name BRAF Gene Symbol BRAF COSMIC ID COSM476 Amino Acid p.V600E Nucleotide c.1799T>A Species Human Gene Aliases BRAF1 RefSeq Accession No. NM_004333.4 UniGeneID Hs.550061 Ensemble Gene Id ENSG00000157764 Entrez Gene ID 673 Unique Assay ID dHsaCP2000028 MiQE Context Sequence CCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTC ACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCAT GAAGAAATATATCTGAGGTGTAGTAAGTAAAG Amplicon Length 91nt Chromosome Location chr7: 140453091-140453213 Probe Fluorophore HEX Assay Design Mutation Assay Probe Purification HPLC Primer Purification Desalted Instrument QX100 ddPCR System Supermix QX100 Droplet PCR SuperMix