ArticlesReal-time qPCR/PCRTechnical Reports

Better, Faster, and Less Expensive Gene Expression Analysis Using Multiplex One-Step RT-qPCR: A Case Study of Colorectal Cancer

Conducting a triplex one-step RT-qPCR assay promises a more efficient and economical analysis of gene expression compared to running three individual assays. This technical report describes a colorectal cancer case study where a triplex multiplex assay was validated.
READ MORE →
AppsArticlesProduct HighlightsReal-time qPCR/PCR

Bio-Rad’s Universal Real-Time PCR App – Everything You Need to Know about Real-Time PCR at Your Fingertips

Bio-Rad’s Universal Real-Time PCR Kits and Reagents work on all real-time PCR systems. Now you can easily compare performance data and get supporting documents for these kits and reagents using Bio-Rad’s new tablet and web app. Learn more and download the app here.
READ MORE →
Real-time qPCR/PCR

PrimePCR ddPCR CNV Assay Validation Data

Gene Name BRCA1 Gene Symbol BRCA1 Species Human Summary breast cancer 1, early onset [Source:HGNC Symbol;Acc:1100] Gene Aliases BRCC1:PPP1R53:RNF53 RefSeq Accession No. NM_007294.3:NM_007299.3:NM_007297.3:NM_007300.3 UniGeneID Hs.194143 Ensemble Gene ID ENSG00000012048 Entrez Gene ID 672 Unique Assay ID dHsaCP1000008 MiQE Context Sequence GTGAAATAAAAGGTAGTATGAGTTCCATCAAGGTGCTTACAGTCTA ATTTAAGGAGACAATGAACCACAAACAATTGTGCCATTAATTCAAA GAGATGATGTCAGCAAACCTAAGAATGTGGG Amplicon Length 82nt Chromosome Location chr17: 41242773-41242895 Probe Fluorophore FAM Assay Design CNV Assay Probe Purification HPLC Primer Purification Desalted Instrument QX200 ddPCR System Supermix QX200 ddPCR Supermix for Probes Assay Specificity > 90% specificity
READ MORE →
ArticlesProduct HighlightsReal-time qPCR/PCR

New PrimePCR™ Probe Assays for Real-time PCR and Droplet Digital™ PCR Technologies

Bio-Rad’s PrimePCR probe assays gave researchers a powerful, reliable set of investigative tools utilizing SYBR® Green detection chemistry. Now Bio-Rad is adding a number of new assays to the PrimePCR portfolio, bringing the benefits of PrimePCR assays to many new applications for both real-time PCR and Droplet Digital™ PCR platforms.
READ MORE →
ArticlesProduct HighlightsReal-time qPCR/PCR

Real-Time PCR Interactive Tutorials — From Reagent Selection to Real-Time PCR Data Analysis

Obtaining accurate quantitative PCR data depends on choosing and validating the proper reagents for a given experiment. These new tutorials present the knowledge base needed to understand the parameters involved in reagent selection in order to get the best results from real-time PCR procedures.
READ MORE →
AppsReal-time qPCR/PCR

PrimePCR™ PCR Primers & Assays

PrimePCR™ assays for real-time PCR and Droplet Digital™ PCR are expertly designed and experimentally validated for guaranteed performance. Ways to order PrimePCR assays: My PrimePCR Reorder previously ordered assays PrimePCR Product Page Search for a gene, disease, or pathway name Unique Assay ID Search for the ID found on the spec sheet  
READ MORE →
ArticlesCustomer StoriesReal-time qPCR/PCR

Amplifying in the Outback: Researcher Brings Real-Time PCR to Australia’s Kimberley Wilderness

Dr. Tim Inglis of the University of Western Australia seeks better ways to conduct surveillance and respond to outbreaks of tropical infectious diseases. For over a decade he’s been developing detection assays for a slate of pathogens. Find out how Bio-Rad’s MiniOpticon Real-Time PCR system allows him to effectively run these assays in such remote locations as the Kimberley Wilderness in Australia’s Top End.
READ MORE →
ArticlesProduct HighlightsReal-time qPCR/PCR

New Premium Hard-Shell Microplate for Applied Biosystems 7500 Fast and ViiA 7 Fast Real-Time PCR systems

Bio-Rad introduces new Hard-Shell 96-well Semi-skirted low profile PCR plates for optimal performance with a variety of real-time PCR systems.
READ MORE →
ArticlesProduct HighlightsReal-time qPCR/PCR

New Roche LightCycler 480 Hard-Shell® Plate That Does Not Warp During Thermal Cycling

Stability during thermal cycling and uniformity of wells are important features in any PCR plate for obtaining reliable results. Bio-Rad’s new Hard-Shell® plates are stable, prevent warping and shrinkage, and are designed for optimal thermal transfer and recovery of samples.
READ MORE →
ArticlesProduct HighlightsReal-time qPCR/PCR

New CFX96 Touch™ Deep Well Real-Time PCR Instrument Enables Large-Volume qPCR Reactions

Large sample volumes may sometimes be needed to conduct gene expression studies. Bio-Rad’s new CFX96 Touch Deep Well™ real-time PCR detection system can run sample volumes up to 125 µl and can discriminate up to five targets simultaneously.
READ MORE →