Articles

In the early 1990s, researcher Alec Morley and his colleagues pioneered digital PCR techniques to measure acute lymphoblastic leukemia. Today, Morley is trying to develop a more accurate way to quantify chronic myeloid leukemia. Find out why he chose Bio-Rad’s Droplet Digital PCR technology for this effort.

What does it take to configure your own chromatography system? Part three of The Chromatography Chronicles examines how the NGC™ chromatography system adapts and grows to meet changing lab needs, and the modular design that makes this possible.

Good data processing practice ensures that protein interaction experiments using a surface plasmon resonance (SPR) system will yield the clearest possible results. Here we present tips for understanding and processing SPR sensorgrams when using Bio-Rad’s ProteOn™ XPR36 protein interaction array system.

Is spending hours in the coldroom just an inevitable part of doing chromatography? The engineers and designers at Bio-Rad believed that, with a little innovation, the answer could be “no.” Part two of The Chromatography Chronicles reveals how they freed the NGC™ medium-pressure chromatography system — and its users — from the coldroom’s chilly confines.

Evaluating potential protein therapies for purity and/or identity represents a vital and highly regulated step in biological drug development. Bio-Rad’s new Biologics Analysis Workflow™ offers a high-throughput, sensitive, and reproducible solution that is cGMP-compliant.

A high quality lab instrument represents a major investment for any researcher. With its new Expert Care service program, Bio-Rad now offers a slate of service plans so its customers can rest assured that their valuable equipment will receive prompt, high-quality support and service at the right level for their needs. Learn about the different options available under the Expert Care service program.

Gene Name BRCA1 Gene Symbol BRCA1 Species Human Summary breast cancer 1, early onset [Source:HGNC Symbol;Acc:1100] Gene Aliases BRCC1:PPP1R53:RNF53 RefSeq Accession No. NM_007294.3:NM_007299.3:NM_007297.3:NM_007300.3 UniGeneID Hs.194143 Ensemble Gene ID ENSG00000012048 Entrez Gene ID 672 Unique Assay ID dHsaCP1000008 MiQE Context Sequence GTGAAATAAAAGGTAGTATGAGTTCCATCAAGGTGCTTACAGTCTA ATTTAAGGAGACAATGAACCACAAACAATTGTGCCATTAATTCAAA GAGATGATGTCAGCAAACCTAAGAATGTGGG Amplicon Length 82nt Chromosome Location chr17: 41242773-41242895 Probe Fluorophore FAM Assay Design CNV Assay Probe Purification HPLC Primer Purification Desalted Instrument QX200 ddPCR System Supermix QX200 ddPCR Supermix for Probes Assay Specificity > 90% specificity

Analyzing protein interaction data using a surface plasmon resonance (SPR) system can be complicated. This user guide describes how to analyze SPR data to obtain kinetic and equilibrium constants, as well as sample concentrations.

Bio-Rad’s PrimePCR probe assays gave researchers a powerful, reliable set of investigative tools utilizing SYBR® Green detection chemistry. Now Bio-Rad is adding a number of new assays to the PrimePCR portfolio, bringing the benefits of PrimePCR assays to many new applications for both real-time PCR and Droplet Digital™ PCR platforms.

Whether through unreliability, lack of workflows, or poor design, chromatography systems can cause major hassles for any lab involved in purifying proteins. Would Bio-Rad be able to solve these longstanding problems? This new series takes an inside look at the development of the NGC medium-pressure chromatography system. This month: bringing customers into the design process.