Articles

Chromatography instruments have a bad reputation in terms of their complexity and difficulty of use. In response, Bio-Rad’s designers and engineers challenged themselves to make the new NGC™ chromatography system as simple and intuitive-to-use as possible. Learn about the new easier-to-use instrument interface they created as a result.

Jefferson County, Tennessee, faced tight school budgets and a mandate to “teach to the test” that left little room for hands-on science learning. Learn how biology professor Lisa Eccles worked to reverse this trend by getting involved with the Science Ambassador program, Bio-Rad’s fast-growing initiative to spark excitement about life science in primary school classrooms.

In the early 1990s, researcher Alec Morley and his colleagues pioneered digital PCR techniques to measure acute lymphoblastic leukemia. Today, Morley is trying to develop a more accurate way to quantify chronic myeloid leukemia. Find out why he chose Bio-Rad’s Droplet Digital PCR technology for this effort.

What does it take to configure your own chromatography system? Part three of The Chromatography Chronicles examines how the NGC™ chromatography system adapts and grows to meet changing lab needs, and the modular design that makes this possible.

Good data processing practice ensures that protein interaction experiments using a surface plasmon resonance (SPR) system will yield the clearest possible results. Here we present tips for understanding and processing SPR sensorgrams when using Bio-Rad’s ProteOn™ XPR36 protein interaction array system.

Is spending hours in the coldroom just an inevitable part of doing chromatography? The engineers and designers at Bio-Rad believed that, with a little innovation, the answer could be “no.” Part two of The Chromatography Chronicles reveals how they freed the NGC™ medium-pressure chromatography system — and its users — from the coldroom’s chilly confines.

Evaluating potential protein therapies for purity and/or identity represents a vital and highly regulated step in biological drug development. Bio-Rad’s new Biologics Analysis Workflow™ offers a high-throughput, sensitive, and reproducible solution that is cGMP-compliant.

A high quality lab instrument represents a major investment for any researcher. With its new Expert Care service program, Bio-Rad now offers a slate of service plans so its customers can rest assured that their valuable equipment will receive prompt, high-quality support and service at the right level for their needs. Learn about the different options available under the Expert Care service program.

Gene Name BRCA1 Gene Symbol BRCA1 Species Human Summary breast cancer 1, early onset [Source:HGNC Symbol;Acc:1100] Gene Aliases BRCC1:PPP1R53:RNF53 RefSeq Accession No. NM_007294.3:NM_007299.3:NM_007297.3:NM_007300.3 UniGeneID Hs.194143 Ensemble Gene ID ENSG00000012048 Entrez Gene ID 672 Unique Assay ID dHsaCP1000008 MiQE Context Sequence GTGAAATAAAAGGTAGTATGAGTTCCATCAAGGTGCTTACAGTCTA ATTTAAGGAGACAATGAACCACAAACAATTGTGCCATTAATTCAAA GAGATGATGTCAGCAAACCTAAGAATGTGGG Amplicon Length 82nt Chromosome Location chr17: 41242773-41242895 Probe Fluorophore FAM Assay Design CNV Assay Probe Purification HPLC Primer Purification Desalted Instrument QX200 ddPCR System Supermix QX200 ddPCR Supermix for Probes Assay Specificity > 90% specificity

Analyzing protein interaction data using a surface plasmon resonance (SPR) system can be complicated. This user guide describes how to analyze SPR data to obtain kinetic and equilibrium constants, as well as sample concentrations.