Bench Buzz – Protein Purification Product Testers
Meet Janna and Tomas. After hearing competing claims about the scalability of next-generation chromatography systems, this dynamic duo took it upon themselves to discover the truth. Now let’s face it, when you think of protein purification you don’t usually think of good times. But somehow Janna and Tomas manage to keep the mood light even as they put the systems to the test by simulating changing protein purification needs. Their conclusion? Vote Yes for Better Chromatography. Vote Yes for Bio-Rad.
2-D Electrophoresis Tips & Tricks — Part I
In the first half of this two-part presentation, Dr. Anton Posch, an expert in 1- and 2-D electrophoresis, provides tips and tricks for the 2DE workflow, covering sample preparation, protein extraction and solubilization, reduction and alkylation of protein side chains, and IEF. The webinar highlights critical success factors and is aimed at both novices and experts wanting to sharpen their skills and keep up on new advances in the field.
2-D Electrophoresis Tips & Tricks — Part II
In the second part of this presentation, Dr. Posch details IEF separation, use of immobilized pH gradient (IPG) strips, running second-dimension PAGE, spot detection, gel matching, and data analysis. The Q&A elaborates on sample preparation, storage, and running conditions.
Buying a New Preparative Protein Purification System – You Have a New Choice
A day in the life of Maria, a post-graduate scientist. Both Maria and her PI are annoyed with their unreliable, out-dated protein purification system, and her PI asks Maria to buy them a new one. She struggles to find a system that meets all their needs until she remembers that Bio-Rad has a new next-generation chromatography system that will work for everyone!
Biologics Analysis Workflow™ – Delivering Increased Throughput, Sensitivity, Reproducibility, and Automation for cGMP Laboratories
Evaluating potential protein therapies for purity and/or identity represents a vital and highly regulated step in biological drug development. Bio-Rad’s new Biologics Analysis Workflow™ offers a high-throughput, sensitive, and reproducible solution that is cGMP-compliant.
Bio-Rad Expert Care — New Service Plans from Bio-Rad’s Service Team
A high quality lab instrument represents a major investment for any researcher. With its new Expert Care service program, Bio-Rad now offers a slate of service plans so its customers can rest assured that their valuable equipment will receive prompt, high-quality support and service at the right level for their needs. Learn about the different options available under the Expert Care service program.
Using Droplet Digital™ PCR to Study Stem Cell Genomes at Stanford University
In this webinar, Prof. Alexander Urban of the Stanford School of Medicine describes how his lab used the QX200™ Droplet Digital™ PCR System to investigate copy number variation (CNV) in induced pluripotent stem cells (iPSCs) that were being used to study the genetics of autism.
Can Droplet Digital™ PCR Detect 22q11.2 Deletion Syndrome?
This presentation by Vicki Hwang details how UC Davis researchers used Droplet Digital PCR (ddPCR™) technology to determine copy number variation (CNV) and characterize the deletion endpoints of the region of chromosome 22 that is deleted in 22q11 deletion syndrome.
PrimePCR ddPCR Mutation Assay Validation Data
Gene Name BRAF Gene Symbol BRAF COSMIC ID COSM476 Amino Acid p.V600E Nucleotide c.1799T>A Species Human Gene Aliases BRAF1 RefSeq Accession No. NM_004333.4 UniGeneID Hs.550061 Ensemble Gene Id ENSG00000157764 Entrez Gene ID 673 Unique Assay ID dHsaCP2000028 MiQE Context Sequence CCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTC ACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCAT GAAGAAATATATCTGAGGTGTAGTAAGTAAAG Amplicon Length 91nt Chromosome Location chr7: 140453091-140453213 Probe Fluorophore HEX Assay Design Mutation Assay Probe Purification HPLC Primer Purification Desalted Instrument QX100 ddPCR System Supermix QX100 Droplet PCR SuperMix
PrimePCR ddPCR CNV Assay Validation Data
Gene Name BRCA1 Gene Symbol BRCA1 Species Human Summary breast cancer 1, early onset [Source:HGNC Symbol;Acc:1100] Gene Aliases BRCC1:PPP1R53:RNF53 RefSeq Accession No. NM_007294.3:NM_007299.3:NM_007297.3:NM_007300.3 UniGeneID Hs.194143 Ensemble Gene ID ENSG00000012048 Entrez Gene ID 672 Unique Assay ID dHsaCP1000008 MiQE Context Sequence GTGAAATAAAAGGTAGTATGAGTTCCATCAAGGTGCTTACAGTCTA ATTTAAGGAGACAATGAACCACAAACAATTGTGCCATTAATTCAAA GAGATGATGTCAGCAAACCTAAGAATGTGGG Amplicon Length 82nt Chromosome Location chr17: 41242773-41242895 Probe Fluorophore FAM Assay Design CNV Assay Probe Purification HPLC Primer Purification Desalted Instrument QX200 ddPCR System Supermix QX200 ddPCR Supermix for Probes Assay Specificity > 90% specificity