Search Result for “primepcr”

Discover the simplicity of crafting your own custom PrimePCR plate with Bio-Rad. Follow along with our intuitive plate wizard, which helps you select your plate type (96- or 384-well) and compatible qPCR instrument for precise assay delivery. Watch this video to see how.

Reference gene selection and validation are very important for gene expression studies that involve different samples or experimental conditions and therefore are absolutely necessary before any further exploration. See how PrimePCR Reference Gene Selection Panels and CFX Maestro Software provide an easy-to-use system with which to select appropriate reference genes.

Tumor metastasis is a complex process. It requires the ability of the cancer cells to invade their surroundings and travel to distant sites and survive. Dr. Traci Lyons studies the mechanism of COX-2 functioning in the metastasis of breast cancer cells. Find out how Dr. Lyons used Bio-Rad’s PrimePCR™ Assays to confirm COX-2 knockdown at the mRNA level.

Traci Lyons describes how PrimePCR Assays ended her laboratory’s struggle to find a qPCR assay that could reliably detect transcription of the cyclooxygenase-2 (Cox-2) gene, which they had identified as potentially prometastatic. Using the PrimePCR Assay for Cox-2, researchers in her lab were finally able to verify cyclooxygenase-2 knockdown, which is a necessary step toward confirming its role in breast cancer metastasis.

A qPCR workflow involves multiple steps, each of which adds to the time and cost of the entire experiment. The PrimePCR™ Assays and Panels from Bio-Rad eliminate a number of these steps with their predesigned primers and probes and help with the assay design. See what steps they eliminate and how that would help expedite your qPCR experiment.

One easy way to obtain a PrimePCR plate customized for your research is to modify one of Bio-Rad’s predesigned panels. This short video tutorial shows you how to use the online tools at Bio-Rad.com to edit a predesigned plate and create, then order your own customized 96- or 384-well PCR plate.

It’s fast and easy to build your own PrimePCR plate. This video walks you through using the Custom Plate Configurator at Bio-Rad.com to create your own 96- or 384-well PCR plate.

A wide range of PCR assays is available through Bio-Rad.com for use with real-time or Droplet Digital™ PCR systems. Get a quick refresher on ordering these products with this short video.

Gene Name BRAF Gene Symbol BRAF COSMIC ID COSM476 Amino Acid p.V600E Nucleotide c.1799T>A Species Human Gene Aliases BRAF1 RefSeq Accession No. NM_004333.4 UniGeneID Hs.550061 Ensemble Gene Id ENSG00000157764 Entrez Gene ID 673 Unique Assay ID dHsaCP2000028 MiQE Context Sequence CCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTC ACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCAT GAAGAAATATATCTGAGGTGTAGTAAGTAAAG Amplicon Length 91nt Chromosome Location chr7: 140453091-140453213 Probe Fluorophore HEX Assay Design Mutation Assay Probe Purification HPLC Primer Purification Desalted Instrument QX100 ddPCR System Supermix QX100 Droplet PCR SuperMix

Gene Name BRCA1 Gene Symbol BRCA1 Species Human Summary breast cancer 1, early onset [Source:HGNC Symbol;Acc:1100] Gene Aliases BRCC1:PPP1R53:RNF53 RefSeq Accession No. NM_007294.3:NM_007299.3:NM_007297.3:NM_007300.3 UniGeneID Hs.194143 Ensemble Gene ID ENSG00000012048 Entrez Gene ID 672 Unique Assay ID dHsaCP1000008 MiQE Context Sequence GTGAAATAAAAGGTAGTATGAGTTCCATCAAGGTGCTTACAGTCTA ATTTAAGGAGACAATGAACCACAAACAATTGTGCCATTAATTCAAA GAGATGATGTCAGCAAACCTAAGAATGTGGG Amplicon Length 82nt Chromosome Location chr17: 41242773-41242895 Probe Fluorophore FAM Assay Design CNV Assay Probe Purification HPLC Primer Purification Desalted Instrument QX200 ddPCR System Supermix QX200 ddPCR Supermix for Probes Assay Specificity > 90% specificity